86
|
Jackson Laboratory
resource source identifier mouse Resource Source Identifier Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm42090287-249-2-13?v=Jackson+Laboratory Average 86 stars, based on 1 article reviews
resource source identifier mouse - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Nacalai
resource source identifier chemicals Resource Source Identifier Chemicals, supplied by Nacalai, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm42030952-121-2-11?v=Nacalai Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Servicebio Inc
resource source identifier mouse anti-ki67 mab servicebio cat#gb121141 Resource Source Identifier Mouse Anti Ki67 Mab Servicebio Cat#Gb121141, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm42309065-274-2-9?v=Servicebio+Inc Average 86 stars, based on 1 article reviews
resource source identifier mouse anti-ki67 mab servicebio cat#gb121141 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
resource source identifier chemicals Resource Source Identifier Chemicals, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/10__1016_slash_j__isci__2025__113899-368-2-11?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Synthego Inc
resource source identifier oligonucleotides gccgtttaagaagatccctg Resource Source Identifier Oligonucleotides Gccgtttaagaagatccctg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm37330910-206-2-10?v=Synthego+Inc Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides gccgtttaagaagatccctg - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
resource source identifier primer Resource Source Identifier Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm34856120-252-2-10?v=Eurofins Average 86 stars, based on 1 article reviews
resource source identifier primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Obio Technology Corp Ltd
resource source identifier oligonucleotides Resource Source Identifier Oligonucleotides, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm38382532-187-2-24?v=Obio+Technology+Corp+Ltd Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Fisher Scientific
resource source identifier chloroform fisher scientific bp11451 2 propanol Resource Source Identifier Chloroform Fisher Scientific Bp11451 2 Propanol, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm41105512-233-2-6?v=Fisher+Scientific Average 86 stars, based on 1 article reviews
resource source identifier chloroform fisher scientific bp11451 2 propanol - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Affinity Biosciences
resource source identifier rabbit anti- fcer1g affinity biosciences df13263 Resource Source Identifier Rabbit Anti Fcer1g Affinity Biosciences Df13263, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/10__1016_slash_j__isci__2025__113687-615-33-40?v=Affinity+Biosciences Average 86 stars, based on 1 article reviews
resource source identifier rabbit anti- fcer1g affinity biosciences df13263 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Partek
resource source identifier org mm e g Resource Source Identifier Org Mm E G, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm41100252-333-2-11?v=Partek Average 86 stars, based on 1 article reviews
resource source identifier org mm e g - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Fine Science Tools
resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps Resource Source Identifier Glad Press N Seal Wrap Glad 240611 000532 Scissor Handle Forceps, supplied by Fine Science Tools, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm41528849-97-3-15?v=Fine+Science+Tools Average 86 stars, based on 1 article reviews
resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
90
|
Stoelting inc
reagent or resource source identifier anymaze Reagent Or Resource Source Identifier Anymaze, supplied by Stoelting inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/resource+source+identifier/pm39163865-131-2-6?v=Stoelting+inc Average 90 stars, based on 1 article reviews
reagent or resource source identifier anymaze - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |